Summary for the 2-nd Site(A)

PID QueryLength FocusSite TITLE
26866 740 2 A RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB;
UniProt Information
AC/IDAC:Q92499 ID:DDX1_HUMAN
Feature Table for 2-th site HELIX:
VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_055453"
REGION: /note="Necessary for interaction with HNRNPK"
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with dsRNA"
REGION: /note="Necessary for interaction with RELA"
CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:37% T:24% A:13% K:6% R:5% L:4% Q:3% P:3% E:2% M:2% N:1% G:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8tbx H (alpha-helix) e (exposed) 47.3
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:2 precipitant:1
Templates for 3D complexes
hetero [79382:Q38FJ3_TRYB2 ] 6yxx_Q_1_R_1 nucleotide [xxxggucauucgcaagaguggccuugcx ] 6o5f_A_1_D_1 [caaggucauucgcaagaguggccxxxxx ] 6o5f_B_1_C_1 precipitant [EDO ] 8iju_A_1_P_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]