#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 589-th Site(I)

PID QueryLength FocusSite TITLE
5303 932 589 I
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
I:70% L:20% F:10% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe T (Hbond turn) b (buried) 14.0
3D Complex Information
Predicted Bind Molecules
nucleotide:6
Templates for 3D complexes
nucleotide [gugggcccx ] 6xqb_A_1_F_1 [xxxxxxugcaucgcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3b_A_1_E_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1 [xxxxxxxxxxxxxxxxxxxaaaaaucugugauuuuaauagxxxxxxxxxxxxxxx ] 8urb_A_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]