Summary for the 37-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
20796 | 198 | 37 K |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:51% A:38% K:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 28.3 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_B_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |