#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 135-th Site(R)

PID QueryLength FocusSite TITLE
9866 346 135 R
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
T:27% R:20% M:17% L:11% K:11% C:9% S:5% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r H (alpha-helix) e (exposed) 56.9
3D Complex Information
Predicted Bind Molecules
nucleotide:3 compound:21
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_E_1_H_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_E_1_H_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_B_1_H_1 compound [K3A ] 5sa4_B_4_C_4 5sa4_B_5_C_5 5sa4_B_6_C_6 [GWG ] 5sa9_B_4_C_4 5sa9_B_5_C_5 5sa9_B_6_C_6 [WJD ] 5sab_B_4_E_4 5sab_B_5_E_5 5sab_B_6_E_6 [EJW ] 5sad_B_4_C_4 5sad_B_5_C_5 5sad_B_6_C_6 [ZQM ] 5sai_B_4_C_4 5sai_B_5_C_5 5sai_B_6_C_6 [S6V ] 7n7r_B_4_C_4 7n7r_B_5_C_5 7n7r_B_6_C_6 [0OI ] 7n7w_B_4_C_4 7n7w_B_5_C_5 7n7w_B_6_C_6


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]