Summary for the 145-th Site(Q) |
PID | QueryLength | FocusSite | TITLE |
19863 | 527 | 145 Q |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:94% K:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | G (3/10-helix) | e (exposed) | 42.3 |
Predicted Bind Molecules |
homo:4 nucleotide:3 |
Templates for 3D complexes |
homo [91796:R1AB_SARS2 ] 7n0d_B_1_K_1 7n0d_D_1_I_1 7n0d_I_1_D_1 7n0d_K_1_B_1 nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_I_1_M_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |