Summary for the 309-th Site(C) |
PID | QueryLength | FocusSite | TITLE |
13010 | 601 | 309 C |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:42% C:35% Y:14% A:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | S (bend) | b (buried) | 11.3 |
Predicted Bind Molecules |
nucleotide:5 compound:1 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [NYV ] 5rlk_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |