#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 2-nd Site(E)

PID QueryLength FocusSite TITLE
4636 527 2 E
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
E:53% Q:33% S:15% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq (coil) e (exposed) 64.8
3D Complex Information
Predicted Bind Molecules
hetero:3 nucleotide:4
Templates for 3D complexes
hetero [30745:Q1T6X8_CVHSA ] 5nfy_B_1_F_1 7n0d_B_1_A_1 7n0d_I_1_H_1 nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]