|
|
| PID | QueryLength | FocusSite | TITLE |
| 20585 | 425 | 79 H | RecName: Full=Mothers against decapentaplegic homolog 3; Short=MAD homolog 3; Short=Mad3; Short=Mothers against DPP homolog 3; Short=hMAD-3;AltName: Full=JV15-2;AltName: Full=SMAD family member 3; Short=SMAD 3; Short=Smad3; Short=hSMAD3; |
| AC/ID | AC:P84022 ID:SMAD3_HUMAN |
| Feature Table for 79-th site |
VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_043793" DOMAIN: /note="MH1" VAR_SEQ: /note="Missing (in isoform 4)" /id="VSP_045348" CHAIN: /note="Mothers against decapentaplegic homolog 3" /id="PRO_0000090856" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
H:35% G:33% F:14% S:10% A:7% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 1ozj |
T (Hbond turn) | e (exposed) | 91.6 |
| Predicted Bind Molecules |
| homo:4 nucleotide:15 precipitant:2 |
| Templates for 3D complexes |
|
homo [31804:SMAD3_HUMAN
] 1ozj_C_1_D_1 1ozj_D_1_C_1 [31552:SMAD5_MOUSE
] 5x6h_A_1_A_2 5x6h_A_2_A_1
nucleotide [atgcgggcgcgcccgcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5mey_A_1_B_1 5mey_A_2_B_2 5nm9_B_1_D_3 5nm9_B_2_D_1 [acgggccgcggcccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5mf0_B_2_D_1 [tgcaggcgcgcctgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5od6_A_1_D_1 6fzt_A_1_C_1 6fzt_B_2_D_2 6tbz_A_1_B_1 6zmn_A_1_D_2 6zmn_B_1_C_1 [gtatggcgccatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6h_A_1_B_1 5x6h_A_2_B_2 [atcagactgccggcagtctataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_D_1_B_1 5x6m_H_1_F_1
precipitant [GOL ] 3kmp_A_1_F_1 3kmp_B_1_H_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 79-th Site(H)