#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 330-th Site(M)
PID QueryLength FocusSite TITLE
23668 346 330 M
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
M:100%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u E (beta-strand) b (buried) 12.6
3D Complex Information
Predicted Bind Molecules
homo:6 nucleotide:3
Templates for 3D complexes
homo [75952:R1AB_CVHSA ] 2ozk_A_1_C_1 2ozk_B_1_D_1 2ozk_C_1_A_1 2ozk_C_1_B_1 2ozk_D_1_A_1 2ozk_D_1_B_1 nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_A_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_A_1_H_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]