Summary for the 135-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
23668 | 346 | 135 R |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:27% R:20% M:17% L:11% K:11% C:9% S:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7u | H (alpha-helix) | e (exposed) | 37.9 |
Predicted Bind Molecules |
nucleotide:2 compound:21 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_E_1_H_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_E_1_H_1 compound [K3A ] 5sa4_B_4_C_4 5sa4_B_5_C_5 5sa4_B_6_C_6 [GWG ] 5sa9_B_4_C_4 5sa9_B_5_C_5 5sa9_B_6_C_6 [WJD ] 5sab_B_4_E_4 5sab_B_5_E_5 5sab_B_6_E_6 [EJW ] 5sad_B_4_C_4 5sad_B_5_C_5 5sad_B_6_C_6 [ZQM ] 5sai_B_4_C_4 5sai_B_5_C_5 5sai_B_6_C_6 [S6V ] 7n7r_B_4_C_4 7n7r_B_5_C_5 7n7r_B_6_C_6 [0OI ] 7n7w_B_4_C_4 7n7w_B_5_C_5 7n7w_B_6_C_6 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |