#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 128-th Site(D)
PID QueryLength FocusSite TITLE
23668 346 128 D
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
N:28% Q:13% A:11% L:10% D:6% E:6% K:6% T:6% V:6% P:5% R:1% G:1% I:1% S:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u T (Hbond turn) e (exposed) 101.9
3D Complex Information
Predicted Bind Molecules
nucleotide:1 precipitant:6
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_C_1_H_1 precipitant [SO4 ] 2gti_A_1_D_1 2gti_A_2_D_2 2gti_A_3_D_3 2gti_A_4_D_4 2gti_A_5_D_5 2gti_A_6_D_6


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]