#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 930-th Site(V)

PID QueryLength FocusSite TITLE
7876 932 930 V
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:58% T:34% I:7% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) e (exposed) 64.7
3D Complex Information
Predicted Bind Molecules
nucleotide:5
Templates for 3D complexes
nucleotide [ugacugcucccuagcaugcuacuaccg ] 8gwe_A_1_J_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwf_A_1_F_1 8gwg_A_1_F_1 8gwi_A_1_F_1 [agcugcucccuagcaugcuacuaccg ] 8gwk_A_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]