Summary for the 688-th Site(A) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 688 A |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:70% S:30% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 27.7 |
Predicted Bind Molecules |
nucleotide:3 compound:1 |
Templates for 3D complexes |
nucleotide [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 compound [NWX ] 7uo4_A_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |