#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 583-rd Site(R)

PID QueryLength FocusSite TITLE
7876 932 583 R
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:44% S:25% A:12% K:11% F:8% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe S (bend) e (exposed) 57.7
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxxxxcuccugugucgucgaacaucgucgaacaucgucxxxxx ] 7dte_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]