Summary for the 546-th Site(Y) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 546 Y |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Y:44% K:30% F:27% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | (coil) | e (exposed) | 37.0 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |