#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 390-th Site(R)

PID QueryLength FocusSite TITLE
5541 601 390 R
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:38% P:12% S:11% C:9% L:9% V:9% A:8% K:4% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7cxm H (alpha-helix) e (exposed) 36.4
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:4 compound:4
Templates for 3D complexes
homo [94384:R1AB_SARS2 ] 7rdx_F_1_E_1 nucleotide [uaaaau ] 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VVG ] 5rl8_A_1_C_1 [VWJ ] 5rlv_A_1_D_1 [PK4 ] 5rm4_B_1_H_1 [6SU ] 5rmc_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]