#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 855-th Site(M)

PID QueryLength FocusSite TITLE
7876 932 855 M
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
M:61% L:32% V:6% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) e (exposed) 29.0
3D Complex Information
Predicted Bind Molecules
nucleotide:22
Templates for 3D complexes
nucleotide [gcgguaguagcaugcuagggagcag ] 7cxm_A_1_E_1 8gw1_A_1_E_1 8gwb_A_1_I_1 8gwe_A_1_I_1 8gwf_A_1_E_1 8gwg_A_1_E_1 8gwi_A_1_E_1 8gwn_A_1_E_1 8gwo_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [agauuaaguuau ] 7dfg_C_1_A_1 [xgcguagcaugcuacgucauucuccuaagaagcua ] 7rdx_A_1_G_1 7rdy_A_1_G_1 7rdz_A_1_G_1 7re0_A_1_G_1 7re1_A_1_G_1 7re3_A_1_H_1 7re3_J_1_O_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_A_1_E_1 [xxxxxxxxxxxxxagcuauuaaaaucacagauu ] 8urb_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]