#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 497-th Site(N)

PID QueryLength FocusSite TITLE
7876 932 497 N
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
N:43% P:17% A:16% K:12% S:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) e (exposed) 62.4
3D Complex Information
Predicted Bind Molecules
nucleotide:2 compound:1
Templates for 3D complexes
nucleotide [gugggcccx ] 6xqb_A_1_F_1 [aagaagcuauuaaaaucaca ] 8g6r_A_1_D_1 compound [H3U ] 7d4f_D_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]