Summary for the 1-st Site(A) |
PID | QueryLength | FocusSite | TITLE |
7585 | 139 | 1 A |
AC/ID | AC:YP_009725306.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n0d | (coil) | e (exposed) | 139.3 |
Predicted Bind Molecules |
hetero:14 nucleotide:6 |
Templates for 3D complexes |
hetero [67986:R1AB_SARS2 ] 7diy_A_1_B_1 7mc5_B_1_A_1 7mc6_B_1_A_1 [28097:R1AB_SARS2 ] 7egq_G_1_F_1 7egq_O_1_N_1 [91796:R1AB_SARS2 ] 7egq_G_1_H_1 7egq_O_1_P_1 7eiz_F_1_I_1 7n0b_A_1_B_1 7n0c_A_1_B_1 7n0d_A_1_B_1 7n0d_C_1_D_1 7n0d_H_1_I_1 7n0d_J_1_K_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_A_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_A_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_A_1_E_1 7n0d_C_1_E_1 7n0d_H_1_L_1 7n0d_J_1_L_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |