|
|
| PID | QueryLength | FocusSite | TITLE |
| 26866 | 740 | 332 Q | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
| AC/ID | AC:Q92499 ID:DDX1_HUMAN |
| Feature Table for 332-th site |
HELIX: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
Q:39% D:13% E:11% L:5% S:5% R:4% N:4% I:4% K:4% M:2% T:2% A:1% G:1% H:1% F:1% Y:1% V:1% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 8tbx |
H (alpha-helix) | b (buried) | 5.6 |
| Predicted Bind Molecules |
| nucleotide:1 precipitant:1 |
| Templates for 3D complexes |
|
nucleotide [auacuuaccuggcaggggagauaccaugaucacgaaggugguuuucccagggcgaggcuuauccauugcacuccggaugugcugaccccugcgauuuccccaaaugugggaaacucgacugcauaauuugugguagugggggacugcguucgcgcuuuccccug ] 6qx9_AA_1_A_1
precipitant [EDO ] 8iju_A_1_I_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 332-nd Site(Q)