Summary for the 316-th Site(P)
PID QueryLength FocusSite TITLE
26866 740 316 P RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB;
UniProt Information
AC/IDAC:Q92499 ID:DDX1_HUMAN
Feature Table for 316-th site DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with dsRNA"
REGION: /note="Necessary for interaction with RELA"
CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
P:20% S:13% T:11% K:7% L:5% V:5% A:4% R:4% E:4% G:4% I:4% N:3% D:3% H:3% M:3% Q:2% F:2% Y:2% C:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8tbx S (bend) e (exposed) 47.3
3D Complex Information
Predicted Bind Molecules
homo:3 nucleotide:12 metal:1 precipitant:1
Templates for 3D complexes
homo [92261:DBP2_YEAST ] 8arp_C_1_F_1 8arp_D_1_A_1 8arp_F_1_C_1 nucleotide [Xggacauauggcuguucgccauuxxxxx ] 7pli_A_1_B_1 7pli_C_1_D_1 7pli_G_1_H_1 7pli_I_1_J_1 7pli_K_1_L_1 [Xggacauauggcuguucgccauxxxxxx ] 7pli_E_1_F_1 [gggaacccuucccaauauggcuguucgccauuucgggaaggguu ] 7pmm_A_1_D_1 [gggaacccuucccaaxauggcuguucgccauuuxgggaaggguu ] 7pmm_B_1_C_1 [gggaaggguuucgacccuucccaauauggcuguucgccauuu ] 7pmq_A_1_H_1 7pmq_B_1_F_1 7pmq_C_1_G_1 7pmq_D_1_E_1 metal [CL ] 3fe2_B_1_E_1 precipitant [EDO ] 8iju_A_1_M_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]