Summary for the 3-rd Site(A)
PID QueryLength FocusSite TITLE
26866 740 3 A RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB;
UniProt Information
AC/IDAC:Q92499 ID:DDX1_HUMAN
Feature Table for 3-th site HELIX:
VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_055453"
REGION: /note="Necessary for interaction with HNRNPK"
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with dsRNA"
REGION: /note="Necessary for interaction with RELA"
CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
S:49% T:19% A:13% K:5% R:3% G:3% Q:2% E:2% N:1% D:1% C:1% H:1% L:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8tbx H (alpha-helix) b (buried) 11.6
3D Complex Information
Predicted Bind Molecules
hetero:3 nucleotide:2
Templates for 3D complexes
hetero [95169:A0A1G4IEQ9_TRYEQ ] 6yxx_Q_1_CA_1 6yxy_J_1_W_1 [91671 ] 7aoi_NB_1_TB_1 nucleotide [caaggucauucgcaagaguggccxxxxx ] 6o5f_A_1_C_1 [xxxggucauucgcaagaguggccuugcx ] 6o5f_B_1_D_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]