Summary for the 21-st Site(D) |
PID | QueryLength | FocusSite | TITLE |
26866 | 740 | 21 D | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
AC/ID | AC:Q92499 ID:DDX1_HUMAN |
Feature Table for 21-th site |
TURN: VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_055453" REGION: /note="Necessary for interaction with HNRNPK" DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:58% K:12% N:8% E:5% A:3% R:3% D:3% H:3% S:3% Q:1% L:1% P:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8tbx | T (Hbond turn) | e (exposed) | 82.7 |
Predicted Bind Molecules |
hetero:1 homo:2 nucleotide:2 compound:10 precipitant:1 |
Templates for 3D complexes |
hetero [69135:GLE1_YEAST ] 3rrm_A_1_B_1 homo [62217:O97032_DUGJA ] 1wrb_A_1_B_2 1wrb_B_2_A_1 nucleotide [xxxggucauucgcaagaguggccuugcx ] 6o5f_A_1_D_1 [caaggucauucgcaagaguggccxxxxx ] 6o5f_B_1_C_1 compound [AMP ] 3ber_A_1_C_1 [ANP ] 5e7m_A_1_B_1 [ADP ] 7pli_E_1_S_1 7pli_G_1_V_1 7pli_I_1_Y_1 7pli_K_1_BA_1 7pmm_B_1_H_1 7pmq_A_1_I_1 7pmq_B_1_L_1 8tbx_A_1_B_1 precipitant [GOL ] 4c9b_A_1_D_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |