#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 560-th Site(V)
PID QueryLength FocusSite TITLE
5303 932 560 V
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
V:44% T:30% C:15% S:12%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk (coil) b (buried) 10.7
3D Complex Information
Predicted Bind Molecules
nucleotide:10
Templates for 3D complexes
nucleotide [xxxxxxxuuuauaacuuaaucxxxxxxxxx ] 7bv2_A_1_E_1 [xxxxxxxxxxxxxxxxxxacuagcuucuuaggagaaxxxx ] 7ctt_A_1_F_1 [cccuauaacuuaaucu ] 7dfg_C_1_B_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_A_1_H_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7re3_A_1_I_1 7re3_J_1_P_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_A_1_F_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacxxx ] 7uo7_A_1_E_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]