#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 6-th Site(G)

PID QueryLength FocusSite TITLE
4636 527 6 G
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
G:81% N:19% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq S (bend) e (exposed) 48.8
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]