#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 104-th Site(N)

PID QueryLength FocusSite TITLE
5815 527 104 N
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
N:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq E (beta-strand) e (exposed) 26.1
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:1 compound:2
Templates for 3D complexes
hetero [28097:R1AB_SARS2 ] 7egq_H_1_F_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 compound [LJA ] 5slf_A_1_H_1 [K1S ] 5smf_A_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]