Summary for the 78-th Site(P) |
PID | QueryLength | FocusSite | TITLE |
13010 | 601 | 78 P |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:28% P:20% R:14% H:14% V:13% K:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | S (bend) | e (exposed) | 98.4 |
Predicted Bind Molecules |
hetero:4 nucleotide:1 |
Templates for 3D complexes |
hetero [28567:R1AB_SARS2 ] 7cxm_I_1_D_1 7rdy_E_1_D_1 7rdy_F_1_B_1 8gwb_E_1_D_1 nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |