#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 33-rd Site(V)
PID QueryLength FocusSite TITLE
4194 198 33 V
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
Q:81% V:11% S:8%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 75.3
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_B_1_F_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_B_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_B_1_E_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]