#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 32-nd Site(E)
PID QueryLength FocusSite TITLE
4194 198 32 E
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
P:44% Q:31% E:11% A:8% S:6%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 37.2
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_B_1_F_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]