Summary for the 64-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
31190 | 346 | 64 K |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:51% G:29% K:12% N:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | S (bend) | e (exposed) | 38.7 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_C_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |