Summary for the 332-nd Site(Q)

PID QueryLength FocusSite TITLE
11352 740 332 Q RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB;
UniProt Information
AC/IDAC:Q92499 ID:DDX1_HUMAN
Feature Table for 332-th site HELIX:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with dsRNA"
REGION: /note="Necessary for interaction with RELA"
CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:39% D:13% E:11% L:5% S:5% R:4% N:4% I:4% K:4% M:2% T:2% A:1% G:1% H:1% F:1% Y:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8tbx H (alpha-helix) b (buried) 5.6
3D Complex Information
Predicted Bind Molecules
nucleotide:1 precipitant:1
Templates for 3D complexes
nucleotide [auacuuaccuggcaggggagauaccaugaucacgaaggugguuuucccagggcgaggcuuauccauugcacuccggaugugcugaccccugcgauuuccccaaaugugggaaacucgacugcauaauuugugguagugggggacugcguucgcgcuuuccccug ] 6qx9_AA_1_A_1 precipitant [EDO ] 8iju_A_1_I_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]