#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 90-th Site(D)
PID QueryLength FocusSite TITLE
4636 527 90 D
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
D:100%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq E (beta-strand) b (buried) 11.7
3D Complex Information
Predicted Bind Molecules
nucleotide:6 metal:20
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 metal [MG ] 5c8s_B_1_J_1 5c8s_D_1_R_1 5c8t_B_1_J_1 5c8t_D_1_Q_1 5c8u_B_1_J_1 5c8u_D_1_P_1 7diy_B_1_G_1 7egq_H_1_GA_1 7egq_P_1_SA_1 7mc6_A_1_M_1 7n0c_B_1_G_1 7n0c_B_1_H_1 7n0d_B_1_Q_1 7n0d_B_1_R_1 7n0d_D_1_X_1 7n0d_I_1_EA_1 7n0d_I_1_FA_1 7n0d_K_1_MA_1 [CA ] 7n0b_B_1_G_1 7n0b_B_1_H_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]