Summary for the 560-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 560 R |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | H (alpha-helix) | b (buried) | 5.1 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |