Summary for the 58-th Site(M) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 58 M |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:91% L:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | e (exposed) | 27.5 |
Predicted Bind Molecules |
nucleotide:6 compound:6 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 compound [UX1 ] 5slu_A_1_G_1 [EJQ ] 5slv_A_1_G_1 [LMW ] 5slx_A_1_G_1 [LQP ] 5slz_A_1_G_1 [I8D ] 5sme_A_1_G_1 [LQV ] 5smi_A_1_G_1 precipitant [TLA ] 7mc5_A_1_Q_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |