#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 555-th Site(R)
PID QueryLength FocusSite TITLE
7876 932 555 R
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
R:100%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) e (exposed) 24.5
3D Complex Information
Predicted Bind Molecules
nucleotide:6 compound:10
Templates for 3D complexes
nucleotide [xxxxxxugcaucgcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3b_A_1_E_1 [xxxxxxxxxxxxxxxxxcugugucgucxxxx ] 7bzf_A_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 compound [F86 ] 7bv2_A_1_K_1 [GE6 ] 7ctt_A_1_J_1 [H3U ] 7d4f_D_1_H_1 [RVP ] 7dfh_A_1_N_1 [NWX ] 7uo4_A_1_G_1 [ATP ] 7uo7_A_1_G_1 [UTP ] 7uo9_A_1_J_1 [GTP ] 7uob_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]