Summary for the 90-th Site(D) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 90 D |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | E (beta-strand) | b (buried) | 11.7 |
Predicted Bind Molecules |
nucleotide:6 metal:20 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 metal [MG ] 5c8s_B_1_J_1 5c8s_D_1_R_1 5c8t_B_1_J_1 5c8t_D_1_Q_1 5c8u_B_1_J_1 5c8u_D_1_P_1 7diy_B_1_G_1 7egq_H_1_GA_1 7egq_P_1_SA_1 7mc6_A_1_M_1 7n0c_B_1_G_1 7n0c_B_1_H_1 7n0d_B_1_Q_1 7n0d_B_1_R_1 7n0d_D_1_X_1 7n0d_I_1_EA_1 7n0d_I_1_FA_1 7n0d_K_1_MA_1 [CA ] 7n0b_B_1_G_1 7n0b_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |