Summary for the 1-st Site(A) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 1 A |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:77% A:23% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | e (exposed) | 132.1 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |