Summary for the 344-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
31190 | 346 | 344 K |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:61% R:23% K:16% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | (coil) | e (exposed) | 35.4 |
Predicted Bind Molecules |
nucleotide:11 compound:18 precipitant:6 |
Templates for 3D complexes |
nucleotide [gu ] 6x1b_A_1_C_1 6x1b_A_2_C_2 6x1b_A_3_C_3 6x1b_B_1_D_1 6x1b_B_2_D_2 6x1b_B_3_D_3 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [xxxxxxxxxxxxgacaaaaaaaaaaaaaaaaaaaa ] 8ud4_E_1_H_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 compound [U5P ] 6wlc_A_1_C_1 6wlc_A_2_C_2 6wlc_A_3_C_3 6wlc_B_1_M_1 6wlc_B_2_M_2 6wlc_B_3_M_3 [CMU ] 6wxc_A_1_C_1 6wxc_A_2_C_2 6wxc_A_3_C_3 6wxc_B_1_M_1 6wxc_B_2_M_2 6wxc_B_3_M_3 [UVC ] 7k1l_A_1_C_1 7k1l_A_2_C_2 7k1l_A_3_C_3 7k1l_B_1_H_1 7k1l_B_2_H_2 7k1l_B_3_H_3 precipitant [EDO ] 6x4i_A_1_I_1 6x4i_A_2_I_2 6x4i_A_3_I_3 6x4i_B_1_S_1 6x4i_B_2_S_2 6x4i_B_3_S_3 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |