Summary for the 334-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
31190 | 346 | 334 K |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:62% E:21% N:17% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | E (beta-strand) | e (exposed) | 50.5 |
Predicted Bind Molecules |
nucleotide:4 precipitant:21 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_A_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 precipitant [ACY ] 6vww_B_1_P_1 6vww_B_2_P_2 6vww_B_3_P_3 [EDO ] 6w01_A_1_F_1 6w01_A_2_F_2 6w01_A_3_F_3 6wlc_A_1_I_1 6wlc_A_2_I_2 6wlc_A_3_I_3 6wxc_A_1_L_1 6wxc_A_2_L_2 6wxc_A_3_L_3 6x4i_A_1_N_1 6x4i_A_2_N_2 6x4i_A_3_N_3 [ACT ] 6wlc_B_1_Q_1 6wlc_B_2_Q_2 6wlc_B_3_Q_3 [FMT ] 6xdh_A_1_F_1 6xdh_A_2_F_2 6xdh_A_4_F_4 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |