Summary for the 321-st Site(L)

PID QueryLength FocusSite TITLE
10705 740 321 L RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB;
UniProt Information
AC/IDAC:Q92499 ID:DDX1_HUMAN
Feature Table for 321-th site STRAND:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with dsRNA"
REGION: /note="Necessary for interaction with RELA"
CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:16% A:13% L:11% G:9% Q:7% C:6% M:6% H:5% I:5% T:4% F:3% S:3% R:2% E:2% K:2% Y:2% N:1% D:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8tbx E (beta-strand) b (buried) 12.4
3D Complex Information
Predicted Bind Molecules
nucleotide:2
Templates for 3D complexes
nucleotide [Xggacauauggcuguucgccauuxxxxx ] 7pli_K_1_L_1 [gggaaggguuucgacccuucccaauauggcuguucgccauuu ] 7pmq_A_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]