Summary for the 321-st Site(L) |
PID | QueryLength | FocusSite | TITLE |
10705 | 740 | 321 L | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
AC/ID | AC:Q92499 ID:DDX1_HUMAN |
Feature Table for 321-th site |
STRAND: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:16% A:13% L:11% G:9% Q:7% C:6% M:6% H:5% I:5% T:4% F:3% S:3% R:2% E:2% K:2% Y:2% N:1% D:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8tbx | E (beta-strand) | b (buried) | 12.4 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [Xggacauauggcuguucgccauuxxxxx ] 7pli_K_1_L_1 [gggaaggguuucgacccuucccaauauggcuguucgccauuu ] 7pmq_A_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |