Summary for the 317-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
10705 | 740 | 317 K | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
AC/ID | AC:Q92499 ID:DDX1_HUMAN |
Feature Table for 317-th site |
DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:17% G:12% R:7% N:7% D:6% L:6% S:6% Q:5% E:5% T:4% A:3% I:3% P:3% W:3% Y:3% V:3% C:2% H:2% M:1% F:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8tbx | (coil) | e (exposed) | 55.2 |
Predicted Bind Molecules |
homo:7 nucleotide:10 |
Templates for 3D complexes |
homo [54145:UAP56_HUMAN ] 1t6n_B_1_A_1 [92261:DBP2_YEAST ] 8arp_A_1_D_1 8arp_B_1_E_1 8arp_C_1_F_1 8arp_D_1_A_1 8arp_E_1_B_1 8arp_F_1_C_1 nucleotide [Xggacauauggcuguucgccauuxxxxx ] 7pli_A_1_B_1 7pli_C_1_D_1 7pli_G_1_H_1 7pli_I_1_J_1 7pli_K_1_L_1 [Xggacauauggcuguucgccauxxxxxx ] 7pli_E_1_F_1 [gggaaggguuucgacccuucccaauauggcuguucgccauuu ] 7pmq_A_1_H_1 7pmq_B_1_F_1 7pmq_C_1_G_1 7pmq_D_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |