Summary for the 2-nd Site(A) |
PID | QueryLength | FocusSite | TITLE |
10705 | 740 | 2 A | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
AC/ID | AC:Q92499 ID:DDX1_HUMAN |
Feature Table for 2-th site |
HELIX: VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_055453" REGION: /note="Necessary for interaction with HNRNPK" DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:37% T:24% A:13% K:6% R:5% L:4% Q:3% P:3% E:2% M:2% N:1% G:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8tbx | H (alpha-helix) | e (exposed) | 47.3 |
Predicted Bind Molecules |
hetero:1 nucleotide:2 precipitant:1 |
Templates for 3D complexes |
hetero [79041:Q38FJ3_TRYB2 ] 6yxx_Q_1_R_1 nucleotide [xxxggucauucgcaagaguggccuugcx ] 6o5f_A_1_D_1 [caaggucauucgcaagaguggccxxxxx ] 6o5f_B_1_C_1 precipitant [EDO ] 8iju_A_1_P_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |