Summary for the 323-rd Site(I) |
PID | QueryLength | FocusSite | TITLE |
11352 | 740 | 323 I | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
AC/ID | AC:Q92499 ID:DDX1_HUMAN |
Feature Table for 323-th site |
STRAND: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:25% I:22% L:21% A:9% F:5% C:4% S:3% M:2% T:2% W:2% R:1% N:1% D:1% Q:1% P:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8tbx | E (beta-strand) | b (buried) | 0.6 |
Predicted Bind Molecules |
nucleotide:1 precipitant:1 |
Templates for 3D complexes |
nucleotide [auacuuaccuggcaggggagauaccaugaucacgaaggugguuuucccagggcgaggcuuauccauugcacuccggaugugcugaccccugcgauuuccccaaaugugggaaacucgacugcauaauuugugguagugggggacugcguucgcgcuuuccccug ] 6qx9_AA_1_A_1 precipitant [EDO ] 8iju_A_1_I_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |