Summary for the 9-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 9 K |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | e (exposed) | 48.1 |
Predicted Bind Molecules |
hetero:22 nucleotide:6 |
Templates for 3D complexes |
hetero [30666:R1AB_CVHSA ] 5c8s_B_1_A_1 5c8s_D_1_C_1 5c8t_B_1_A_1 5c8t_D_1_C_1 5c8u_B_1_A_1 5c8u_D_1_C_1 5nfy_A_1_E_1 5nfy_B_1_F_1 5nfy_C_1_H_1 5nfy_D_1_G_1 7diy_B_1_A_1 7egq_H_1_G_1 7egq_P_1_O_1 7eiz_I_1_F_1 7mc5_A_1_B_1 7mc6_A_1_B_1 7n0b_B_1_A_1 7n0c_B_1_A_1 7n0d_B_1_A_1 7n0d_D_1_C_1 7n0d_I_1_H_1 7n0d_K_1_J_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |