#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 251-st Site(G)
PID QueryLength FocusSite TITLE
4636 527 251 G
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
G:68% K:15% A:2% L:2% R:1% N:1% D:1% Q:1% E:1% I:1% F:1% P:1% S:1% T:1% Y:1% V:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq S (bend) e (exposed) 34.5
3D Complex Information
Predicted Bind Molecules
nucleotide:6
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]