#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 187-th Site(A)
PID QueryLength FocusSite TITLE
4636 527 187 A
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
A:52% S:29% G:14% C:5%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq S (bend) e (exposed) 40.2
3D Complex Information
Predicted Bind Molecules
nucleotide:5 metal:6 precipitant:1
Templates for 3D complexes
nucleotide [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 metal [MG ] 5c8s_B_1_J_1 5c8t_B_1_J_1 5c8t_D_1_Q_1 5c8u_B_1_J_1 5c8u_D_1_P_1 [CA ] 7n0b_B_1_H_1 precipitant [EDO ] 7mc6_A_1_K_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]