Summary for the 102-nd Site(G) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 102 G |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | S (bend) | e (exposed) | 59.5 |
Predicted Bind Molecules |
hetero:19 nucleotide:6 compound:1 precipitant:1 |
Templates for 3D complexes |
hetero [30666:R1AB_CVHSA ] 5c8s_B_1_A_1 5c8s_D_1_C_1 5c8t_B_1_A_1 5c8t_D_1_C_1 5c8u_B_1_A_1 5c8u_D_1_C_1 5nfy_B_1_F_1 5nfy_C_1_H_1 7eiz_I_1_F_1 7mc5_A_1_B_1 7mc6_A_1_B_1 7n0c_B_1_A_1 7n0d_B_1_A_1 7n0d_D_1_C_1 7n0d_I_1_H_1 7n0d_K_1_J_1 [27995:R1AB_SARS2 ] 7egq_H_1_F_1 7egq_P_1_N_1 7eiz_I_1_E_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 compound [K1S ] 5smf_A_1_H_1 precipitant [EDO ] 7mc5_A_1_K_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |