Summary for the 202-nd Site(K) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 202 K |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:79% R:13% Q:8% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | (coil) | b (buried) | 7.5 |
Predicted Bind Molecules |
nucleotide:1 compound:1 |
Templates for 3D complexes |
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_E_1_T_1 compound [JHJ ] 5rma_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |