Summary for the 177-th Site(N) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 177 N |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
N:93% S:7% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | (coil) | e (exposed) | 30.9 |
Predicted Bind Molecules |
nucleotide:2 compound:2 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxn_I_1_G_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 compound [VWM ] 5rlz_A_1_C_1 [VXG ] 5rmm_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |