#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 146-th Site(K)
PID QueryLength FocusSite TITLE
5541 601 146 K
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
K:100%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7cxm H (alpha-helix) b (buried) 15.1
3D Complex Information
Predicted Bind Molecules
nucleotide:3 compound:2
Templates for 3D complexes
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [LJA ] 5rl6_B_1_H_1 [VXD ] 5rml_B_1_H_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]